circad | circRNAs associated with diseases

circRNA_0046366
Gene	FASN	Organism	Human
Genome Locus	chr17:80048757-80048945:-	Build	hg19
Disease	Hepatic Steatosis	ICD-10	Fatty (change of) liver, not elsewhere classified (K76.0)
DBLink	Link to database	PMID	29391755
Experimental Method
Sample Type	HepG2 cells	Comparison	HepG2 cells normal and stimulated conditions
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CGTCCATTCGTTTGTGAGCC Reverse CTTCACAGCCTCATCGGAGC	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Guo, XY, Sun, F, Chen, JN, Wang, YQ, Pan, Q, Fan, JG (2018). circRNA_0046366 inhibits hepatocellular steatosis by normalization of PPAR signaling. World J. Gastroenterol., 24, 3:323-337.